Home

Faceți bine Neînfricat Cămilă table primer sequence Măduvă Prânz Ordine alfabetică

PPT - Supplementary Table 1 Sequences of quantative RT-PCR primers PowerPoint Presentation - ID:5610790
PPT - Supplementary Table 1 Sequences of quantative RT-PCR primers PowerPoint Presentation - ID:5610790

Table 1. Primer sequences, the expected product size for each used primer-set, and the appropriate annealing temperature used for PCR (Metabion) [4,5,6,13] : Mycobacterial Interspersed Repetitive Unit-variable Number Tandem Repeat (MIRU-VNTR) Typing
Table 1. Primer sequences, the expected product size for each used primer-set, and the appropriate annealing temperature used for PCR (Metabion) [4,5,6,13] : Mycobacterial Interspersed Repetitive Unit-variable Number Tandem Repeat (MIRU-VNTR) Typing

Supplementary Table 2. Primer List Primer Description Sequence
Supplementary Table 2. Primer List Primer Description Sequence

View Image
View Image

View Image
View Image

View Image
View Image

Table S6. List of primers (Sequence 5' to 3') used in this study.
Table S6. List of primers (Sequence 5' to 3') used in this study.

Table of primers a Primer name Base position b Sequence 533 | Download Table
Table of primers a Primer name Base position b Sequence 533 | Download Table

Primer sequences used for Cyproquant assays Table shows position of... | Download Table
Primer sequences used for Cyproquant assays Table shows position of... | Download Table

The primer sequences for qRT-PCR. | Download Table
The primer sequences for qRT-PCR. | Download Table

Table S2. Primer Sequences
Table S2. Primer Sequences

Tables_Page_1.jpg
Tables_Page_1.jpg

Table SI. Primer sequences for RT‑qPCR. Product Forward primer sequence Reverse primer sequence IL‑6 GAGGATACCACTCCCAACAGACC
Table SI. Primer sequences for RT‑qPCR. Product Forward primer sequence Reverse primer sequence IL‑6 GAGGATACCACTCCCAACAGACC

Table 2. Primer sequences and PCR protocol used for the RT-PCR assay : Benzoin Thiosemicarbazone Inhibits Growth and Triggers Apoptosis in Earlich Ascites Carcinoma Cells through an Intrinsic Pathway : Science and
Table 2. Primer sequences and PCR protocol used for the RT-PCR assay : Benzoin Thiosemicarbazone Inhibits Growth and Triggers Apoptosis in Earlich Ascites Carcinoma Cells through an Intrinsic Pathway : Science and

Supplementary Table 1: primer sequences - ppt download
Supplementary Table 1: primer sequences - ppt download

Primer sequences table. | Download Table
Primer sequences table. | Download Table

PCR Primer Sequences | Download Table
PCR Primer Sequences | Download Table

View Image
View Image

Supplementary Table 2: Primer sequences and DHPLC conditions
Supplementary Table 2: Primer sequences and DHPLC conditions

Table of RT-PCR primer sequences | Download Table
Table of RT-PCR primer sequences | Download Table

Table 1 from Guelph Guelph , ON , Canada Single-Primer Amplification of Flanking Sequences | Semantic Scholar
Table 1 from Guelph Guelph , ON , Canada Single-Primer Amplification of Flanking Sequences | Semantic Scholar

View Image
View Image

Table S3. Primers Used for SURVEYOR Assays, Related to Experimental Procedures primer name genomic target primer sequence (5'
Table S3. Primers Used for SURVEYOR Assays, Related to Experimental Procedures primer name genomic target primer sequence (5'

View Image
View Image

JCI Insight - Brd4-p300 inhibition downregulates Nox4 and accelerates lung fibrosis resolution in aged mice
JCI Insight - Brd4-p300 inhibition downregulates Nox4 and accelerates lung fibrosis resolution in aged mice

JCI - E-cadherin expression on multiple myeloma cells activates tumor-promoting properties in plasmacytoid DCs
JCI - E-cadherin expression on multiple myeloma cells activates tumor-promoting properties in plasmacytoid DCs

Table S1. List of primers used in study. Name of Primer Sequence of
Table S1. List of primers used in study. Name of Primer Sequence of

P. Azad et al. 1 SI Table S1 Primer sequences of genes tested by
P. Azad et al. 1 SI Table S1 Primer sequences of genes tested by